MA), respectively. The primer sets (Bioneer) used for the cDNA amplification
MA), respectively. The primer sets (Bioneer) utilized for the cDNA amplification had been as follows: UHRF1, five CAGTTAACATGGGGGTTTTTGCTGTCCC and 5 -GACTCGAGTCACCGGCCATTGCCGTA; WNT5A, 5 -CAGTTAACATGAAGAAGTCCATTGG and 5 -GACTCGAGTCACTTGCACACAA. The amplified cDNA fragments have been inserted into HpaI and XhoI websites with the pCMMP-MCS-IRESRFP vector (Addgene). To create recombinant retrovirus, H29D cells, a modified 293T cell line, was cultured in DMEM (Invitrogen) as described CDK5 Protein medchemexpress previously (39) and transfected with retroviral plasmids containing target cDNAs utilizing Lipofectamine reagent (Invitrogen). The virus-containing medium (supernatant) was harvested each day for 4 days. The harvested virus supernatant was filtered by way of a 0.45- m filter unit (UFC 920008, EMD Millipore Corp., Darmstadt, Germany) and stored at 80 .VOLUME 292 sirtuininhibitorNUMBER 9 sirtuininhibitorMARCH 3,Experimental Procedures Cell Culture and Improvement of Senescence–Primary HDFs isolated from the foreskin of a 5-year-old boy by a technique described previously (5) had been cultured in DMEM supple-3736 JOURNAL OF BIOLOGICAL CHEMISTRYThe UHRF1/DNMT1 Axis Regulates Cell SenescenceConstruction in the Promoter-Luciferase Reporter Plasmid and Promoter Assay–The human DNMT1 promoter area of 657 bp ( 344 to 313, NC_000019.10) was cloned by targeted PCR against total genomic DNA of Chang cells, an immortalized standard hepatocyte cell line (ATCC) employing the primer set five -TTACGCGTCCCACACACTGGGTATAG and five -TGCAGATCTCTGCGGACATCGTCG. The amplified DNMT1 promoter region was inserted in between the MluI and BglII web-sites on the pGL3-basic vector (Promega, Fitchburg, WI), creating the pGL3-DNMT1 promoter reporter plasmid (pGL3-DNMT1pro). Following construction, the inserted promoter was confirmed by DNA sequencing. To monitor DNMT1 promoter activity, cells have been transfected using a total of 1 g of DNA (950 ng in the cloned reporter plasmid and 50 ng of thymidine kinase promoter-driven Renilla luciferase plasmid as an internal handle) working with FuGENE HD reagent. Just after two days, the luciferase activity of cell extracts was measured by Synergy 2 multimode reader (BioTek Instruments, Inc., Winooski, VT) in accordance with the protocol supplied with all the Dual-Luciferase reporter assay program (Promega). The luciferase activities were normalized by the Renilla luciferase activity. Gene Expression Profiling and Data Analysis–Total RNA was amplified and purified to yield biotinylated cRNA as described previously (5). Briefly, total RNA isolated from HDFs for microarray hybridization was amplified and purified applying the Ambion Illumina RNA amplification kit (Ambion, Austin, TX). Labeling and hybridization to the human HT-12 v4 expression bead chip array was performed according to the directions on the manufacturer (Illumina Inc., San Diego, CA). Raw information had been obtained applying GenomeStudio software (Illumina Inc.), filtered by detection p value (p 0.05), and additional processed by log2 transformation and quantile FGF-15 Protein MedChemExpress normalization. The gene set analysis of biological function was performed making use of David application (https://david.ncifcrf.gov/). All data preprocessing functions and subsequent information evaluation had been performed employing R/Bioconductor packages. Estimation of Intracellular ROS Level–To estimate intracellular ROS level, cells were stained with 10 M two ,7 -dichlorodihydrofluorescein diacetate (Molecular Probes, Eugene, OR) for 15 min at 37 . Stained cells have been washed, resuspended in PBS, and analyzed by flow cytometry (FACS Vantage, BD Bio.